Translating RNA into Protein

docs/src/rosalind/08-prot.md

@@ -0,0 +1,207 @@
+# Translating RNA into Protein
+
+🤔 [Problem link](https://rosalind.info/problems/prot/)
+
+!!! warning "The Problem"
+
+    The 20 commonly occurring amino acids are abbreviated by using 20 letters from the English alphabet.  
+    (all letters except for B, J, O, U, X, and Z).   
+    Protein strings are constructed from these 20 symbols.   
+    Henceforth, the term genetic string will incorporate protein strings along with DNA strings and RNA strings.  
+
+    The RNA codon table dictates the details regarding the encoding of specific codons into the amino acid alphabet.
+
+    Given: An RNA string s corresponding to a strand of mRNA.  
+    (of length at most 10 kbp).
+
+    Return: The protein string encoded by s.
+
+    Sample Dataset
+    ```
+    AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA
+    ```
+
+    Sample Output
+    ```
+    MAMAPRTEINSTRING
+    ```
+
+### DIY solution
+Let's tackle this problem by writing our own solution,  
+and then seeing how we can solve it with functions already available in BioJulia. 
+
+First, we will check that this is a coding region by verifying that the string starts with a start codon (`AUG`).   
+If not, we can still convert the string to protein,   
+but we'll throw a warning to alert the user.  
+There may be a frame shift,   
+in which case the returned translation will be incorrect.
+
+We'll also do a check that the string is divisible by three.   
+If it is not, this will likely mean that there was a mutation in the string 
+(addition or deletion).   
+Again, we can still convert as much of the string as possible.   
+However, we should alert the user that the result may be incorrect!
+
+Next, we'll need to convert this string of mRNA to a string of proteins using the RNA codon table.  
+We can convert the RNA codon table into a dictionary,   
+which can map over our codons.
+Alternatively, we could also import this from the BioSequences package,   
+as this is already defined [there](https://github.com/BioJulia/BioSequences.jl/blob/b626dbcaad76217b248449e6aa2cc1650e95660c/src/geneticcode.jl#L132).
+
+Then, we'll break the string into codons by slicing it every three characters.     
+These codons can be matched against the RNA codon table to get the corresponding amino acid.   
+We'll join all these amino acids together to form the final string.
+
+Lastly, we'll need to deal with any three-character strings that don't match a codon.   
+This likely means that there was a mutation in the input mRNA string!   
+If we get a codon that doesn't match,   
+we can return "X" for that amino acid,   
+and continue translating the rest of the string.  
+If we get a string of X's,   
+that should signal to the user that there was some kind of frame shift. 
+
+
+Now that we have established an approach,  
+let's turn this into code!
+
+```julia
+using Test
+
+rna = "AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA"
+
+# note: this can be created by hand
+# or it can be accessed from the BioSequences package (see link above)
+codon_table = Dict(
+            "AAA" => 'K', "AAC" => 'N', "AAG" => 'K', "AAU" => 'N',
+            "ACA" => 'T', "ACC" => 'T', "ACG" => 'T', "ACU" => 'T',
+            "AGA" => 'R', "AGC" => 'S', "AGG" => 'R', "AGU" => 'S',
+            "AUA" => 'I', "AUC" => 'I', "AUG" => 'M', "AUU" => 'I',
+            "CAA" => 'Q', "CAC" => 'H', "CAG" => 'Q', "CAU" => 'H',
+            "CCA" => 'P', "CCC" => 'P', "CCG" => 'P', "CCU" => 'P',
+            "CGA" => 'R', "CGC" => 'R', "CGG" => 'R', "CGU" => 'R',
+            "CUA" => 'L', "CUC" => 'L', "CUG" => 'L', "CUU" => 'L',
+            "GAA" => 'E', "GAC" => 'D', "GAG" => 'E', "GAU" => 'D',
+            "GCA" => 'A', "GCC" => 'A', "GCG" => 'A', "GCU" => 'A',
+            "GGA" => 'G', "GGC" => 'G', "GGG" => 'G', "GGU" => 'G',
+            "GUA" => 'V', "GUC" => 'V', "GUG" => 'V', "GUU" => 'V',
+            "UAA" => '*', "UAC" => 'Y', "UAG" => '*', "UAU" => 'Y',
+            "UCA" => 'S', "UCC" => 'S', "UCG" => 'S', "UCU" => 'S',
+            "UGA" => '*', "UGC" => 'C', "UGG" => 'W', "UGU" => 'C',
+            "UUA" => 'L', "UUC" => 'F', "UUG" => 'L', "UUU" => 'F',
+        )
+
+function translate_mrna(seq, codon_table)
+
+    # check if starts with start codon
+    if ! startswith(seq, "AUG")
+        @warn "this sequence does not start with AUG"
+    end
+    # check if string is divisible by three
+    if rem(length(seq), 3) != 0
+        @warn "this sequence is not divisible by 3"
+    end
+    # separate string into codons
+    # this makes a generator, which allocates less memory than a vector
+    codons = (join(chunk) for chunk in Iterators.partition(seq, 3))
+
+    # map over codons with codon table, return X if not in codon_table
+    aa_string = join(get(codon_table, c, "X") for c in codons)
+
+    # return amino acid string
+    return aa_string 
+
+end
+
+translate_mrna(rna, codon_table)
+```
+
+Let's test that our function correctly deals with non-conventional mRNA strings. 
+
+If we change the input string to include a codon that is not present in the codon table,   
+we should get a warning.  
+The codon should also be translated to an amino acid "X."  
+```julia
+translate_mrna("AUGNCG", codon_table)
+```
+
+Next, let's confirm that an input mRNA strand with a length that is not divisible by 3 produces the correct warning.
+
+```julia
+translate_mrna("AUGGC", codon_table)
+```
+
+
+
+
+
+### BioSequences Solution
+
+An alternative way to approach this problem would be to leverage 
+an established function from the BioSequences package in BioJulia.
+
+```julia
+using BioSequences
+
+translate(rna"AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA")
+
+```
+
+This function is straightforward to use,
+especially in the case where the input mRNA has no ambiguous codons 
+and is divisible by 3.   
+However, there are also additional parameters available for handling other types of strings.
+
+For instance, the function defaults to using the standard genetic code.  
+However, if a user wishes to use another codon chart  
+(for example, yeast or invertebrate),   
+there are others available on [BioSequences.jl](https://github.com/BioJulia/BioSequences.jl/blob/b626dbcaad76217b248449e6aa2cc1650e95660c/src/geneticcode.jl#L130) to choose from. 
+
+
+For example, we can translate the same input mRNA string  
+using the vertebrate mitochondrial genetic code! 
+
+```julia
+translate(rna"AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA", code=BioSequences.vertebrate_mitochondrial_genetic_code) 
+
+```
+
+By default, `allow_ambiguous_codons` is `true`.   
+If a user gives the function a mRNA string with ambiguous codons that may not be found in the standard genetic code,  
+these codons will be translated to the narrowest amino acid   
+which covers all
+non-ambiguous codons encompassed by the ambiguous codon.  
+If this option is turned off,  
+ambiguous codons will cause an error.
+
+For example, the input mRNA string below includes the nucleotides `NCG`,  
+which is an ambiguous codon.
+This could potentially code for `ACG` (Threonine),   
+`CCG` (Proline), `UCG` (Serine), `GCG` (Alanine),    
+each of which would code for four different amino acids.  
+
+`allow_ambiguous_codons` is `true` by default,    
+so this mRNA strand is translated to `MX`.
+
+```julia
+translate(rna"AUGNCG")
+```
+
+However, if `allow_ambiguous_codons` is changed to `false`,   
+an error is thrown, as no ambiguous codons are allowed in the result. 
+
+```julia
+translate(rna"AUGNCG", allow_ambiguous_codons=false)
+```
+
+Additionally, `alternative_start` is `false` by default.  
+If set to true, the starting amino acid will be Methionine regardless of what the first codon is.
+
+```julia
+translate(rna"AUCGAC", alternative_start = true)
+```
+
+Similar to our function, the BioSequences function also throws an error if the input mRNA string is not divisible by 3.
+
+```julia
+translate(rna"AUGGA")
+```